Presentation is loading. Please wait.

Presentation is loading. Please wait.

PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 6 주차 조교 : 전지선.

Similar presentations


Presentation on theme: "PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 6 주차 조교 : 전지선."— Presentation transcript:

1 PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 6 주차 조교 : 전지선

2 Introduction. Site-specific mutagenesis 1. Single base mutation. 2. Multiple mutation. 3. Insertion. 4. Deletion. The types of mutagenesis. The cause of mutagenesis. 1. UV. 2. Chemical-Carcinogen. 3. Error prone of PCR. 4. Site-directed mutagenesis.

3 Primary PCR Primer 1 Primer 3 1 Cycle Primer 4 Primer 2 1 Cycle 2 Cycle 뺄 것뺄 것 Overlap Extension PCR 5’3’5’3’ 5’ 3’

4 Ligation PCR Primer 4 Primer 1 1 Cycle 2 Cycle Primer 로써 기능 !! Overlap Extension PCR

5 뺄 것뺄 것 1 atggctgccgttgccatgacacccaaccctgtgcagacccttcag l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l taccgacggcaacggtactgtgggttgggacacgtctgggaagtc 46gaggaggcggtgtgcgccatctgcctcgattacttcacggacccc l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l ctcctccgccacacgcggtagacggagctaatgaagtgcctgggg 91gtgtccatcggctgcgggcacaacttctgccgagtttgtgtaacc l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l cacaggtagccgacgcccgtgttgaagacggctcaaacacattgg F1: 5’- atggctgccgttgccatgac -3’ R3: 3’- ctgggaagtccacaggtagc -5’ F2: 5’- gacccttcaggtgtccatcg -3’ R4: 3’- agacggctcaaacacattgg -5’

6 1. Agarose gel : membrane binding solution = 10 mg : 10 ㎕ 씩 넣어 55 ℃ heat block 에 서 10 분간 녹인다. 2. 잘 녹았는지를 vortexing 을 통해 확인 후, sample 을 column 으로 옮긴다. 3. 14000rpm, 1min centrifuge 4. Wash buffer 750 ㎕ 를 넣은 후 14000rpm, 1 min centrifuge 5. 한번 더 14000rpm, 1 min centrifuge 하여 남은 wash buffer 를 제거한다. 6. Column 을 새 tube 에 옮긴 후 D.W. 를 30 ㎕ 를 넣고 5 분을 기다린다. 7. 14000rpm, 5 min centrifuge Experimental Procedure : Gel Extraction

7 Experimental Procedure : Ligation PCR Ligation PCR Component Quantity per reaction Targets 1-10kb Distilled water 34 ㎕ 5x Herculase II reaction buffer 10 ㎕ dNTP mix 0.5 ㎕ DNA template(1+3) 1 ㎕ DNA template(2+4) 1 ㎕ Primer 1+4 2.5 ㎕ Herculase II fusion DNA polymerase 1 ㎕ Total reaction volume 50 ㎕ PCR condition Temp.( ℃ ) Time 952 min 9530 sec 5530 sec 721 min 725 min 30 cycles

8 T-vector cloning. PCR fragment for cloning into T-vector. 1.PCR product 5’ 끝에 phosphate 가 없다. - In vitro DNA synthesizer 는 DNA 3’  5’ 으로 합성 2. Taq DNA polymerase -Terminal deoxynucleotidyl transferase (TdT) activity

9 Lac Z 을 이용한 selection Galactose Glucose + β-galactosidase X-Gal Blue color Glucose + β-galactosidase Inhibitor Lactose X-gal  used to indicate whether a bacterium expresses the β -galactosidase enzyme, which is encoded by the lac Z gene, in a technique called blue/white screening.

10 Lac Z 을 이용한 selection

11 Amp/LacZ 를 이용한 selection

12 Experimental Procedure 1. T-vector ligation ◈ Ligation volume setting ng of vector size of vector : ng of insert size of insert = 1 : 5 IngredientVolume ( ul) 2x ligation buffer5 T-vector0.5 PCR construct (insert)3.5 T4 DNA ligase1 Total10 Ligation time 1. Overnight at 16 ℃ 2. 1 ~ 2 hours at Room temperature

13 2. Transformation Control insert (542bp) Positive controlSelf-ligation No insert Experimental Procedure

14 16hr 3. Bacteria culture 4. Plasmid DNA Extraction 5. Cloning confirmation using two-cut digestion Experimental Procedure

15 1.Gel extraction solution 의 원리 조사 2.Primary PCR, Ligation PCR 과정을 그려보기 (DNA strands, primer, polymerase 가 포함되어 있어야 하며, 단계별 온도 를 표기 할 것.) 3.Lac operon 원리 4. 결과 분석 5. PCR-mediated PCR primer design (Red blank 인 부분을 deletion 하는 construct, primer 4 개 design 할 것 ) Report – 결과 및 고찰 Membrane Wash Solution 1.10mM potassium acetate (pH 5.0) 2. 80% ethanol 3. 16.7μM EDTA (pH 8.0) Membrane Binding Solution 1. 4.5M guanidine isothiocyanate 2. 0.5M potassium acetate (pH 5.0)

16 1 atggctgccgttgccatgacacccaaccctgtgcagacccttcag 46 gaggaggcggtgtgcgccatctgcctcgattacttcacggacccc 91 gtgtccatcggctgcgggcacaacttctgccgagtttgtgtaacc 136 cagttgtggggtggggaggatgaggaggacagagatgagttagat 181 cgggaggaggaggaggaggacggagaggaggaggaagtggaggct 226 gtgggggctggcgcggggtgggacacccccatgcgggatgaagac 271 tacgagggtgacatggaggaggaggtcgaggaggaagaagagggt 316 gtgttctggaccagtggcatgagcaggtccagctgggacaacatg 361 gactatgtgtgggaggaggaggacgaggaggaagacctggactac 406 tacttgggggacatggaggaggaggacctgaggggggaggatgag 451 gaggacgaggaggaagtgctggaggaggttgaggaagaggatcta 496 gaccccgtcaccccactgcccccgcctccagcccctcggaggtgc 541 ttcacatgccctcagtgccgaaagagctttcctcggcggagcttc 586 cgccccaacctgcagctggccaatatggtccaggtgattcggcag 631 atgcacccaacccctggtcgagggagccgcgtgaccgatcagggc 676 atctgtcccaaacaccaagaagccctgaagctcttctgcgaggta 721 gacgaagaggccatctgtgtggtgtgccgagaatccaggagccac 766 aaacagcacagcgtggtgccattggaggaggtggtgcaggagtac 811 aaggccaaactgcaggggcacgtggaaccactgaggaagcacctg 856 gaggcagtgcagaagatgaaagccaaggaggagaggcgagtgaca 901 gaactgaagagccagatgaagtcagagctggcagcggtggcctcg 946 gagtttgggcgactgacacggtttctggctgaagagcaggcaggg 991 ctggaacggcgtctcagagagatgcatgaagcccagctggggcgt 1036 gcgggagccgcggctagtcgccttgcagaacaggccgcccagctc 1081 agccgcctgctggcagaggcccaggagcggagccagcaggggggt 1126 ctccggctgctccaggacatcaaggagactttcaataggtgtgaa Report - 결과 및 고찰

17 제출기한 : 2013 년 10 월 24 일 중간고사 시험 후 제출 > 이 후 제출 시 태도점수 감점 Hand-writing 미 제출 시 0 점 처리 조교 : 전지선 (010-5001-8061) 과학원 S303 호 ( 내선 7642) Report

18 생화학 실험 (2) 중간고사 일시 : 10 월 24 일 목요일 7-8 교시 장소 : 과학관 B131 Exam.


Download ppt "PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 6 주차 조교 : 전지선."

Similar presentations


Ads by Google