Genomics Lab Teaching Assistant Jaehun Shin

Presentation on theme: "Genomics Lab Teaching Assistant Jaehun Shin"— Presentation transcript:

1 Genomics Lab Teaching Assistant Jaehun Shin
분자생물학 Part.2 Cloning Genomics Lab Teaching Assistant Jaehun Shin

2 Cloning Gene clone이란 같은 유전자를 갖는 집합이며, Gene cloning 이란 이러한 clone을 만드는 과정이다. Gene cloning으로 DNA를 자르고 붙이고 변형시켜 실험에 필요한 Recombinant DNA를 제조한다.

3 Workflow 유전자 얻기(Insert 준비) 원하는 target gene sequence를 얻는 과정.
Vector 삽입 vector와 insert의 end가 complementary binding 할수 있도록 Digestion 해주고, Ligation하는 과정. 세포내로 주입(Transformation) DNA를 bacteria cell내로 주입 Clone의 확인 Bacterial cell에서 recombinant DNA만을 얻고, 원하는 유전정보를 가지고 있는지 restriction을 통해 확인

4 Contents DNA PCR ( week 1 ) Gel extraction ( week 2 )
DNA ligation ( week4 ) Transformation ( week4 ) Plasmid DNA miniprep ( week5 ) Confirmation of cloned plasmid by restriction enzyme digestion ( week6 )

5 1 week DNA PCR

6 PCR PCR(polymerase chain reaction)법은 DNA 또는 RNA의 특정영역을 시험관 내에 대량으로 증폭하는 획기적인 기술이다. PCR증폭효율에 영향을 미치는 요인으로는 ① 각 단계의 반응온도와 시간, ② cycle수, ③ 반응액 조성(주형 DNA, dNTP농도, Mg2+농도 등), ④ primer 설계, ⑤ 사용 DNA polymerase 등이 있다. Denaturation, Annealing, Extension 3단계를 거친다.

7 PCR의 단계 Denaturation Annealing Extension

8 PCR의 단계 Denaturation Annealing Extension
두가닥의 DNA를 약 94℃에서 15~30초간 처리하여 각각 한가닥의 DNA로 분리시키는 과정이다. 온도를 너무 높이거나 너무 오랜시간 처리하면 내열성 DNA polymerase라고 하여도 activity를 잃어버리므로 주의하여야 한다. Annealing 열처리로 만들어진 ssDNA와 primer가 있는 상태에서 온도를 낮추면 2종류(Forward,Reverse)의 primer는 각각의 complementary ssDNA Template에 annealing한다. Annealing에 적합한 온도와 시간은 primer의 sequence와 그 길이에 따라 결정된다. Extension 4종류의 기질(dNTP)이 공존하는 상태에서, DNA polymerase를 작용시켜 primer이후의 sequence를 polymerization 한다. 보통 extension의 시간은 1Kb/m 으로 하여 계산한다.

9 Primer Them6 (F,R) Rbpms2 (F,R) Hist1h2ad (F,R)

10 Method Primer mixture 2ul cDNA 3ul DEPC 15ul 3가지를 PCR premix에 넣어준다.
Suspension 해준다. PCR

11 Gel extraction & DNA PCR
2 week Gel extraction & DNA PCR

12 Gel extraction Agarose는 45℃부터 100 ℃ 상태로 온도를 올리면 agarose 중합체는 액체 상태로 되지만, 온도를 서서히 낮추면 일정한 구조를 이루면서 결합하게된다. 이러한 분자간의 결합에는 수소결합과 문분자와의 상호작용이 필수적이다.

13 Gel extraction 이러한 결합은 물분자가 필수적이기 때문에 물분자를 빼앗아버리면 결합력은 약하게 된다.
Chaotropic agent는 수소결합을 억제하는 물질로 Agarose와 만나면 물분자와 강한 수소결합을 하여 Agarose로 부터 물분자를 빼앗고, 결국 녹는점이 낮아져 55 ℃상태에서 녹아버리게 된다.

14 Gel extraction 또한 Chaotropic agent는 높은 salt농도로, DNA가 녹아있는 chaotropic agent 를 silica에 넣어주면 Salt는 ion bridge를 형성하여 결국 DNA를 silica에 붙이게 된다. 이후 low salt buffer(TE, DDW)를 넣어주면 더 이상 salt는 bridge역할을 하지못하고, DNA는 밑으로 내려가게 된다.

15 Method 1. Excise the agarose gel with a clean scalpel. • Remove the extra agarose gel to minimize the size of the gel slice. 2. Transfer up to 300 mg of the gel slice into a microcentrifuge tube. • The maximum volume of the gel slice is 300mg. 3. Add 500 µl of FADF Buffer to the sample and mix by vortexing. • For > 2% agarose gels, add 1000 µl of FADF Buffer. 4. Incubate at 55 °C for 5 ~10 minutes and vortex the tube every 2 ~ 3 minutes until the gel slice dissolved completely. • During incubation, interval vortexing can accelerate the gel dissolved. • Make sure that the gel slice has been dissolved completely before proceed the next step. • After gel dissolved, make sure that the color of sample mixture is yellow. If the color is violet, add 10 µl of sodium acetate, 3M, pH 5.0. Mix well to make the color of sample mixture turned to yellow. 5. Cool down the sample mixture to room temperature. And place a FADF Column into a Collection Tube. 6. Transfer 800 µl of the sample mixture to the FADF Column. Centrifuge at 11,000 x g for 30 seconds, then discard the flow-through. • If the sample mixture is more than 800 µl, repeat this step for the rest of the sample mixture. 7. Add 750 µl of Wash Buffer (ethanol added) to the FADF Column. Centrifuge at 11,000 x g for 30 seconds, then discard the flow-through. • Make sure that ethanol ( %) has been added into Wash Buffer when first use. 8. Centrifuge again at full speed (~ 18,000 x g) for an additional 3 minutes to dry the column matrix. • Important step ! The residual liquid should be removed thoroughly on this step. 9. Place the FADF Column to a new microcentrifuge tube (not provided). 10. Add 40 µl of Elution Buffer or ddH2O to the membrane center of the FADF Column. Stand the FADF Column for 1 min. • Important step ! For effective elution, make sure that the elution solution is dispensed onto the membrane center and is absorbed completely. • Important : Do not elute the DNA using less than suggested volume (40 µl). It will lower the final yield. 11. Centrifuge at full speed (~ 18,000 x g) for 1 min to elute the DNA. 12. Nano drop

16 Method Primer mixture 2ul cDNA 3ul DEPC 15ul 3가지를 PCR premix에 넣어준다. (Primer와 cDNA를 맞춰서 넣어준다.) Suspension 해준다. PCR

17 3 week Gel extraction

18 Method 1. Excise the agarose gel with a clean scalpel. • Remove the extra agarose gel to minimize the size of the gel slice. 2. Transfer up to 300 mg of the gel slice into a microcentrifuge tube. • The maximum volume of the gel slice is 300mg. 3. Add 500 µl of FADF Buffer to the sample and mix by vortexing. • For > 2% agarose gels, add 1000 µl of FADF Buffer. 4. Incubate at 55 °C for 5 ~10 minutes and vortex the tube every 2 ~ 3 minutes until the gel slice dissolved completely. • During incubation, interval vortexing can accelerate the gel dissolved. • Make sure that the gel slice has been dissolved completely before proceed the next step. • After gel dissolved, make sure that the color of sample mixture is yellow. If the color is violet, add 10 µl of sodium acetate, 3M, pH 5.0. Mix well to make the color of sample mixture turned to yellow. 5. Cool down the sample mixture to room temperature. And place a FADF Column into a Collection Tube. 6. Transfer 800 µl of the sample mixture to the FADF Column. Centrifuge at 11,000 x g for 30 seconds, then discard the flow-through. • If the sample mixture is more than 800 µl, repeat this step for the rest of the sample mixture. 7. Add 750 µl of Wash Buffer (ethanol added) to the FADF Column. Centrifuge at 11,000 x g for 30 seconds, then discard the flow-through. • Make sure that ethanol ( %) has been added into Wash Buffer when first use. 8. Centrifuge again at full speed (~ 18,000 x g) for an additional 3 minutes to dry the column matrix. • Important step ! The residual liquid should be removed thoroughly on this step. 9. Place the FADF Column to a new microcentrifuge tube (not provided). 10. Add 40 µl of Elution Buffer or ddH2O to the membrane center of the FADF Column. Stand the FADF Column for 1 min. • Important step ! For effective elution, make sure that the elution solution is dispensed onto the membrane center and is absorbed completely. • Important : Do not elute the DNA using less than suggested volume (40 µl). It will lower the final yield. 11. Centrifuge at full speed (~ 18,000 x g) for 1 min to elute the DNA. 12. Nano drop

19 DNA ligation & Transformation
4 week DNA ligation & Transformation

20 Ligation Ligation은 enzyme의 작용을 통해 두개의 nucleic acid가 결합하는 것이다. 이는
Molecular cloning에 필수적인 절차로 외부 DNA fragment를 Plasmid(Vector)에 insertion한다. DNA fragment의 말단은 3'-hydroxyl과 5’-phosphoryl사이 phosphodiester bonds를 이룬다. Cofactor는 ATP와 NAD+가 있다. T4 DNA ligase : cofactor로 ATP를 사용 E.coli DNA ligase : cofactor로 NAD+를 사용 T4 DNA ligase는 E.coli DNA ligase에 비해 blunt end에도 작용하는 힘이 더 크기 때문에 T4 DNA ligase가 더 많이 사용된다.

21 Ligation T4 DNA ligase Enzyme내 lysine residue(-NH)에 ATP가 결합하여 AMP가 Enzyme에 공유결합 Nicked DNA의 5’phosphate에 AMP전달 Nicked DNA의 3’OH와 phosphate backbone의 sealing으로 DNA-AMP결합이 끊어져 AMP가 떨어져나간다.

22 T-vector T-vector cloning
T-vector는 PCR product를 cloning할 때, 많이 사용되는 vector이다. Taq polymerase는 polymerization시 3’end에 dA를 붙이는 성질이 있어 PCR product에 돌출된 염기를 갖고 있다. T-vector는 이러한 성질을 바탕으로 고안되었으며, vector 3’end에 dT 돌출 염기를 갖고 있다.

23 T vector Insert DNA는 453bp 자리에 들어가게 된다.

24 Insert DNA Them6 >CCDS27527.1
ATGCTGGAGCTGTTGGTGGCGTCGTTATCCCTGGCGCTCGCCTTCTTTGC GCTGCTGGACGGCTGGTACCTGGTGCGCGTGCCGTGTGCTGTTCTGCGCG CACGCTTGCTGCAGCCGCGGGTCCGCGACTTATTGGCGGAGCAGCGGTAT GCCGGCCGGGTGCTGCCATCGGACCTGGACCTGCTGCTACACATGAACAA CGCGCGCTACCTGCGCGAGGCGGATGTGGCGCGCGCTGCGCACCTGACCC GCTGCGGTGTGCTGGGGGCGCTGCGCGACCTGAACGCGCACACGGTGCTG GCCGCCTCGTGCGCGCGCTATCGCCGCTCGCTGCGCCTGTTTGAGCCGTT CGAGGTACACACGCGACTGCAAGGCTGGGACGACCGCGCCTTCTACCTGG AGGCGCGTTTTGTCAGCCTTCGCGATGGTTTCGTGTGCGCCTTGCTGCGT TTCCGACAGCACGTGCTGGGCACCTCGCCGGATCGAGTAGTACAGCACTT GTGCAAACGGAGGGTGGAGCCCCCTGAGCTGCCAGAAGACTTGAAACATT GGATCTCCTACAATGAGACCAGCAGCCAGCTGCTCCGTGCTGAGAGCGGC CTC AGT GAC AGA AAG GAC CAG TGA 674

25 Insert DNA Rbpms2 >CCDS23296.1
ATG AGC AAC CTG AAG CCG GAC GTC GAGCACTGCACGGGCGCGGGCACCGG CAGCCCGCTGGAGGAGGAGGTCCGCACACTGTTTGTCAGTGGCCTCCCTG TGGATATTAAACCTAGAGAACTCTACCTGCTCTTCCGTCCATTCAAGGGC TATGAAGGGTCCCTGATCAAGCTCACCTCAAGACAGCCTGTTGGTTTTGT GATCTTTGACAGCCGGGCAGGAGCGGAAGCAGCCAAAAACGCATTGAATG GTATTCGCTTTGATCCGGAGAACCCGCAGACCCTGAGGCTAGAGTTTGCC AAAGCCAACACCAAGATGGCCAAGAGCAAACTAATAGCGACACCAAATCC CACCAGTGTCCACCCTGCTCTAGGAGCACACTTGATCGCCCGGGACCCTT ATGACCTGATGGGGACTGCTCTGATTCCTGCATCCCCAGAGGCCTGGGCC CCTTACCCTCTCTACACCACAGAGCTGACCCCAGCCATTTCACATACCAC GTTCACCTACCCAGCTGCCACTGCTGCTGCTGCTGCCGCCGCCACCCTAC ATGCTCAGGTGCGCTGGTACCCCTCCTCTGACACCACCCAGCAAGGATGG AAG TAC CGC CAG TTC TGT TAG 671

26 Insert DNA Hist1h2ad >CCDS26351.1
ATG TCT GGA CGC GGC AAA CAG GGT GGC AAGGCTCGCGCCAAGGCCAAGAC CCGCTCCTCCCGGGCCGGCCTGCAGTTCCCCGTGGGCCGCGTGCACCGGC TGCTCCGCAAGGGCAACTACTCGGAGCGCGTGGGCGCCGGCGCCCCGGTG TACCTGGCGGCCGTGCTGGAGTACCTGACGGCCGAGATCCTGGAGCTGGC GGGCAACGCGGCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACC TGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCCGC GTGACCATCGCGCAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCT GCCC AAG AAG ACC GAG AGC CAC CAC AAG GCC AAG GGG AAA TAA 393

27 Method 10x ligation buffer A 10x ligation buffer B
Vector DNA 2ul (50ug) Insert DNA xul (200ug) DEPC water to final volume of 20ul 1 day 4 °C incubation

28 Transformation Plasmid 란?
플라스미드(Plasmid)는 세균의 세포내에 복제되어 독자적으로 증식할 수 있는 염색체 이외의 DNA 분자를 일컫음 Plasmid는 세균의 생존에 필수적이지는 않으며, 다른 종의 세포 내에도 전달될 수 있음 위 성질을 이용하여 세균 내 플라스미드를 세포 밖으로 빼내고 제한효소로 자른 뒤 필요로 하는 유전자를 삽입하여 이를 사디 세균에 넣어 배양하는 유전자 재조합 기술을 사용함

29 Plasmid Vector의 특징 Origin of replication (ori)
Multiple Cloning Sites (MCS) Circular form DNA Antibiotic resistance Restriction enzyme site

30 Transformation 외부로부터 주어진 DNA에 의하여 생물의 유전적인 성질이 변하는 일을 말함 Transformed
Recombinant Plasmid Transformed Cell E.Coli Host Cell

31 Competent Cell (Com. Cell)
정상적인 bacteria cell에 이러한 물리적, 화학적 처리를 하여 외부의 DNA가 잘 들어갈 수 있도록 만든 cell을 competent cell이라고 함 E.coli를 포함한 대부분의 박테리아는 일반적인 환경에서 극히 제한된 양의 DNA만을 받아들임 효과적으로 transformation 하기 위하여 박테리아는 DNA를 받아 들이는 능력을 향상시키는 물리적, 화학적 형태의 처리가 필요로 함

32 Com. Cell 제조 과정 Plasmid bound To cell exterior CaCl2 treatment
Normal Bacterium Plasmid transported Into the cell Competent cell Heat shock 42℃ for 2 minutes Transformed cell

33 Method 1. competent cell을 물에서 1/3정도 녹인다. (10~20초)
2. Ligation한 DNA를 넣고 1초 vortex. 3. Ice에 10 min incubation 4. LB plate에 도말한다. 5. 37 °C 에서 18h 배양후 colony 관찰. 6. colony를 액체LB로 옮겨준다.

34 5 week DNA Miniprep

35 Miniprep Miniprep Miniprep은 DNA를 소량 추출한다는 뜻으로, plasmid DNA 추출이 그 목적이다. Competent의 membrane을 깨고 chromosomal DNA와 plasmid DNA를 구분하여 분리 한다. Chromosomal DNA는 plasmid DNA에 비해 size가 크기 때문에 이러한 성질을 이용하여 분리할 수 있다.

36 DNA prep method Boiling method
Plasmid를 지닌 bacteria는 lysozyme, Triton, 열처리 등으로 깨어질수 있는데, chromosomal DNA는 세포막에 결합된 상태로 남아있게 되고 원심분리로서 침전시켜 모을수 있으며 plasmid DNA는 상등액에서 isopropanol로 침전시켜 분리 할수 있음 Boiling miniprep은 적은 양의 plasmid를 분리할 때 쓰이는 방법이지만 분리된 plasmid DNA는 Alkaline lysis miniprep보다 quality가 떨어짐

37 DNA prep method Alkaline lysis method 가장 일반적으로 쓰이는 분리 방법
Plasmid DNA는 Plasmid을 지니고 있는 bacteria에서 적은 양의 배양으로 분리될 수 있는데, Bacteria는 sodium dodecyl sulfate (SDS), NaOH를 함유하는 용액으로 처리하여 용균되어 진다 Potassium acetate를 첨가하여 혼합액을 중성화시키는데 이것을 covalently closed plasmid DNA를 빠르게 reanneal 시킨다 Chromosomal DNA와 bacterial proteins의 대부분은 침전되며 침전물은 원심분리로서 제거할 수 있다 Plasmid DNA는 상등액에 남아있게 되고 ethanol precipitation으로 집중시킬 수가 있다

38

39 Method 1. Pellet up to 5 ml of the bacterial culture by centrifugation for 5 min at 10,000 xg in a tabletop centrifuge. Discard the supernatant as much as possible. 2. Resuspend pelleted bacterial cells thoroughly in 250 ul of Buffer S1. Transfer the suspension to a new 1.5 ml tube. 3. Add 250 ul of Buffer S2 and mix by inverting the tube 4 times (DO NOT VORTEX). 4. Add 350 ul of Buffer G3 and immediately mix by inverting the tube 4-6 times (DO NOT VORTEX). 5. Centrifuge for 10 min. 6. Transfer carefully the supernatant to a spin column by decanting or pipetting. Centrifuge for 30 sec. Remove the spin column, discard the pass-through, and re-insert the spin column to the collection tube. 7. Apply 700 ul of Buffer PW and centrifuge for 30 sec. Remove the spin column, discard the pass-through, and re-insert the spin column to the collection tube. 8. Centrifuge for an additional 1 min to remove residual wash buffer. Transfer the spin column to a new 1.5 ml tube (Not provided). 9. Add 50 ul of Buffer EB or deionized distilled water, let stand for 1 min, and centrifuge for 1 min. 10. Nano drop

40 Confirmation of plasmid restriction enzyme digestion
6 week Confirmation of plasmid restriction enzyme digestion

41 Restriction Enzyme 이란? Double strand DNA 의 3-8 nucleotide로 구성하는 특이적 배열을 식별하며 double strand DNA를 절단하는 핵산내부가수분해 효소를 말함 효소 활성에 필요한 인자의 요구성과 절단양식의 차이에 따라 I형, II형, III형 으로 분류함

42 Restriction Enzyme 이란? Sticky end Blunt end EcoR I Pst I HPaII Nde I
Xho I Blunt end Sma I Hpa II

43 T Vector Restriction sites

44 Method 각 각의 DNA 1ug를 준비한다 Restriction Enzyme을 1ul 씩 넣어 준다
10X cutsmart Buffer를 5ul 넣어 준다 DEPC water를 total volume 50ul까지 넣어준다 37℃에 overnight incubation해준다 Agarose gel에 걸어 확인 하여 본다.