PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 6 주차 조교 : 전지선.

Slides:



Advertisements
Similar presentations
생화학 실험 (2) 5주차 Subcloning Ⅱ : Detection of Subcloning - Rapid Microscale Isolation of Plasmid from Transformed Cells 담당교수 : 하상준 교수님 담당조교 : 조소영.
Advertisements

Mini-prep, Restriction Enzyme 분자생물학실험 SUBJECT. Sequence blast Restriction enzyme Mini-prep E.coli transformation TA Ligation PCR DNA EXTRACTION 분자생물학실험.
Competent Cell. Competent Cell? DNA 를 받아들일 수 있는 능력을 가진 cell 효과적으로 Transformation 하기 위해 정상 의 Bacteria cell 에 물리적, 화학적 처리를 가하여 외부의 DNA 가 잘 들어갈 수 있도록 만든.
5. 중합효소 연쇄반응 (polymerase Chain Reaction). 중합효소 연쇄반응 (polymerase chain reaction, PCR) 특정 DNA 부위를 특이적으로 반복 합성하여 시험관내에서 원하는 DNA 분자를 증폭 1986 년 Kary Mullis.
담당 교수님 : 김건수 교수님 담당 조교님 : 김익중 조교님 생명과학과 안혁근 서강대학교 Sogang university DNA microarray 를 이용 한 유전자 differential expression 정량측정 실험.
전기영동 ELECTOPHORESIS 생물환경학과 김 정 호.
중합효소연쇄반응 (PCR). Polymerase Chain Reaction (PCR)  중합효소연쇄반응  주형 DNA 분자의 특정 부분을 선택적으로 증폭 Primer set 와 내열성 DNA polymerase 를 이용하여 짧은 시간 내에 미량의 시료에서  Kary.
2장. 분자생물학에서의 유전적 분석 분자생물학.
Preparation and concentration determination of plasmid DNA from E.coli
RNA isolation from monolayer cell
Chapter.20 DNA sequencing을 이용한 지중해성 빈혈의 원인.
식품의약품안전청 _KJYDGP DNA Methylation by EZ DNA Methylateion-Gold Kit (ZYMO RESEARCH) 1-2. The Sample list 1-1. The Method of Methylation.
Phosphorylation 전의 마지막 결과 2% agarose 10% PAA gel ( 첫번째 ) 대상 : HPP (0~6) lane 1: oligomer mixture lane 2: hybridization (70->37) lane 3: ligation (16 도,
1 Clinical Biochemistry Lab. College of Health Science, Department of Biomedical Laboratory Science SDS-PAGE gel making Clinical chemistry experiment.
2-1. 플라즈미드 DNA vector.
Double & Triple Blocking by DNA Binding Protein
Transformation Biology experiment.
genotyping P M1 M2 F1 F2 N Primer 바꾸기전 : hetero일 경우 175, 280에서 2개의
Gal4-UAS System in Drosophila melanogaster
Genomics Lab Teaching Assistant Jaehun Shin
Contents 1. 실험 목적 2. 실험 배경 이론 3. 실험 원리 및 방법 4. 실험 결과 및 분석
Gene Cloning(유전자 클로닝) 유전자 클로닝 정의. 유전자 클로닝의 등장배경. 유전자 클로닝의 중요성
유전공학 5장. DNA 정제.
1) 미생물의 배양법 미생물이란 LB배지 미생물 배양 방법 고체배양 : 사면배양/ 천자배양 …
IV. 건강에 대한 나의 관심분야 3. 줄기세포, 유전자치료
GENETIC TECHNOLOGY 생물학개론 15주차 강의
분자 생물학 5장. 핵산 취급 기술.
RNA analysis.
핵산의 성질과 분리 생물환경학과 김 정 호.
Molecular Biological Tools in the Environmental Engineering
Yeast two- hybrid system 을 활용한 Mycobacterium smegmatis 의 일산화탄소 산화관련 유사 유전자와 상호작용하는 단백질 분석 이정은.
PCR mediated mutagenesis 생화학 실험 II
∘ 체세포분열과 생식세포분열의 특징을 비교하시오.
분자생물학실험 SUBJECT Electrophoresis 결과 확인, Sequence blast
PCR (Polymerase Chain Reaction) Ⅰ
Technical Tips & Cautions
Sub Cloning 학기 생화학실험(2) 담당교수 : 송재환 교수님 담당조교 : 한수연 CONTENTS
제 2장 발효와 미생물 1. 유용미생물의 분리와 보존 2. 균주의 개량 - 균주개량의 기본원리 - 돌연변이 - 유전자 재조합
RT-PCR법을 이용한 결핵 검출법 (SLAN장비의 소개)
분자생물학실험 Total RNA extraction RNA quantitation CDNA synthesis RT-PCR
4-α-Glucanotransferase에 의해 백설기의 변형된 전분에 대한 구조적 특성
분자생물학실험 Introduction.
Mammalian cell culture Ⅲ (Real-time PCR)
PCR과 Electrophoresis를 이용한 chromosomal DNA의 복제 및 분석
4.Mendelian segregation
유전자 발현 분석 (Analysis of Gene Expression )
Y chromosome and Multiplex PCR
2nd Class Sub Cloning 학기 생화학실험(2) 담당교수 : 송재환 교수님 담당조교 : 이해경
분자생물학실험 SUBJECT DNA extraction.
Development & Cell Differentiation Laboratory
제16장 유전공학-첨단분야.
제15장. 유전체 조작과 연구 유전체 사업 유전공학 분자도구들 생명 윤리.
PCR mediated mutagenesis 생화학 실험 II
2018-2학기 생명과학실험기법 Reverse transcription PCR & Real-Time PCR.
Genome Project 고해상도 유전지도 및 물리지도를 제작하여 질병관련 유전자의 위치를 확인한다.
Negative PCR control I 2% agarose 10% PAA
Western blot.
MRNA Quantification.
Mammalian cell culture Ⅰ
제11장 유전공학 11.1 DNA 변형과 조작을 위한 분자적 도구들
PCR (Polymerase Chain Reaction) Ⅱ
세포생물학 및 실험 학기 생명과학과 박태식 교수님 화요일 (1-4 교시) Real time PCR (Q-PCR)
Restriction enzyme Ⅰ.
6장. 정제된 DNA 의 조작 유전공학.
Western blot 생명과학 실험기법 (12주차).
Western blot.
제14장 유전자의 발현 조절.
Restriction enzyme Ⅱ.
가천대학교 생명과학과 학기 생명과학실험기법.
Site directed mutagenesis를 이용한 유전자의 기능 분석
Presentation transcript:

PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 6 주차 조교 : 전지선

Introduction. Site-specific mutagenesis 1. Single base mutation. 2. Multiple mutation. 3. Insertion. 4. Deletion. The types of mutagenesis. The cause of mutagenesis. 1. UV. 2. Chemical-Carcinogen. 3. Error prone of PCR. 4. Site-directed mutagenesis.

Primary PCR Primer 1 Primer 3 1 Cycle Primer 4 Primer 2 1 Cycle 2 Cycle 뺄 것뺄 것 Overlap Extension PCR 5’3’5’3’ 5’ 3’

Ligation PCR Primer 4 Primer 1 1 Cycle 2 Cycle Primer 로써 기능 !! Overlap Extension PCR

뺄 것뺄 것 1 atggctgccgttgccatgacacccaaccctgtgcagacccttcag l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l taccgacggcaacggtactgtgggttgggacacgtctgggaagtc 46gaggaggcggtgtgcgccatctgcctcgattacttcacggacccc l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l ctcctccgccacacgcggtagacggagctaatgaagtgcctgggg 91gtgtccatcggctgcgggcacaacttctgccgagtttgtgtaacc l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l cacaggtagccgacgcccgtgttgaagacggctcaaacacattgg F1: 5’- atggctgccgttgccatgac -3’ R3: 3’- ctgggaagtccacaggtagc -5’ F2: 5’- gacccttcaggtgtccatcg -3’ R4: 3’- agacggctcaaacacattgg -5’

1. Agarose gel : membrane binding solution = 10 mg : 10 ㎕ 씩 넣어 55 ℃ heat block 에 서 10 분간 녹인다. 2. 잘 녹았는지를 vortexing 을 통해 확인 후, sample 을 column 으로 옮긴다 rpm, 1min centrifuge 4. Wash buffer 750 ㎕ 를 넣은 후 14000rpm, 1 min centrifuge 5. 한번 더 14000rpm, 1 min centrifuge 하여 남은 wash buffer 를 제거한다. 6. Column 을 새 tube 에 옮긴 후 D.W. 를 30 ㎕ 를 넣고 5 분을 기다린다 rpm, 5 min centrifuge Experimental Procedure : Gel Extraction

Experimental Procedure : Ligation PCR Ligation PCR Component Quantity per reaction Targets 1-10kb Distilled water 34 ㎕ 5x Herculase II reaction buffer 10 ㎕ dNTP mix 0.5 ㎕ DNA template(1+3) 1 ㎕ DNA template(2+4) 1 ㎕ Primer ㎕ Herculase II fusion DNA polymerase 1 ㎕ Total reaction volume 50 ㎕ PCR condition Temp.( ℃ ) Time 952 min 9530 sec 5530 sec 721 min 725 min 30 cycles

T-vector cloning. PCR fragment for cloning into T-vector. 1.PCR product 5’ 끝에 phosphate 가 없다. - In vitro DNA synthesizer 는 DNA 3’  5’ 으로 합성 2. Taq DNA polymerase -Terminal deoxynucleotidyl transferase (TdT) activity

Lac Z 을 이용한 selection Galactose Glucose + β-galactosidase X-Gal Blue color Glucose + β-galactosidase Inhibitor Lactose X-gal  used to indicate whether a bacterium expresses the β -galactosidase enzyme, which is encoded by the lac Z gene, in a technique called blue/white screening.

Lac Z 을 이용한 selection

Amp/LacZ 를 이용한 selection

Experimental Procedure 1. T-vector ligation ◈ Ligation volume setting ng of vector size of vector : ng of insert size of insert = 1 : 5 IngredientVolume ( ul) 2x ligation buffer5 T-vector0.5 PCR construct (insert)3.5 T4 DNA ligase1 Total10 Ligation time 1. Overnight at 16 ℃ 2. 1 ~ 2 hours at Room temperature

2. Transformation Control insert (542bp) Positive controlSelf-ligation No insert Experimental Procedure

16hr 3. Bacteria culture 4. Plasmid DNA Extraction 5. Cloning confirmation using two-cut digestion Experimental Procedure

1.Gel extraction solution 의 원리 조사 2.Primary PCR, Ligation PCR 과정을 그려보기 (DNA strands, primer, polymerase 가 포함되어 있어야 하며, 단계별 온도 를 표기 할 것.) 3.Lac operon 원리 4. 결과 분석 5. PCR-mediated PCR primer design (Red blank 인 부분을 deletion 하는 construct, primer 4 개 design 할 것 ) Report – 결과 및 고찰 Membrane Wash Solution 1.10mM potassium acetate (pH 5.0) 2. 80% ethanol μM EDTA (pH 8.0) Membrane Binding Solution M guanidine isothiocyanate M potassium acetate (pH 5.0)

1 atggctgccgttgccatgacacccaaccctgtgcagacccttcag 46 gaggaggcggtgtgcgccatctgcctcgattacttcacggacccc 91 gtgtccatcggctgcgggcacaacttctgccgagtttgtgtaacc 136 cagttgtggggtggggaggatgaggaggacagagatgagttagat 181 cgggaggaggaggaggaggacggagaggaggaggaagtggaggct 226 gtgggggctggcgcggggtgggacacccccatgcgggatgaagac 271 tacgagggtgacatggaggaggaggtcgaggaggaagaagagggt 316 gtgttctggaccagtggcatgagcaggtccagctgggacaacatg 361 gactatgtgtgggaggaggaggacgaggaggaagacctggactac 406 tacttgggggacatggaggaggaggacctgaggggggaggatgag 451 gaggacgaggaggaagtgctggaggaggttgaggaagaggatcta 496 gaccccgtcaccccactgcccccgcctccagcccctcggaggtgc 541 ttcacatgccctcagtgccgaaagagctttcctcggcggagcttc 586 cgccccaacctgcagctggccaatatggtccaggtgattcggcag 631 atgcacccaacccctggtcgagggagccgcgtgaccgatcagggc 676 atctgtcccaaacaccaagaagccctgaagctcttctgcgaggta 721 gacgaagaggccatctgtgtggtgtgccgagaatccaggagccac 766 aaacagcacagcgtggtgccattggaggaggtggtgcaggagtac 811 aaggccaaactgcaggggcacgtggaaccactgaggaagcacctg 856 gaggcagtgcagaagatgaaagccaaggaggagaggcgagtgaca 901 gaactgaagagccagatgaagtcagagctggcagcggtggcctcg 946 gagtttgggcgactgacacggtttctggctgaagagcaggcaggg 991 ctggaacggcgtctcagagagatgcatgaagcccagctggggcgt 1036 gcgggagccgcggctagtcgccttgcagaacaggccgcccagctc 1081 agccgcctgctggcagaggcccaggagcggagccagcaggggggt 1126 ctccggctgctccaggacatcaaggagactttcaataggtgtgaa Report - 결과 및 고찰

제출기한 : 2013 년 10 월 24 일 중간고사 시험 후 제출 > 이 후 제출 시 태도점수 감점 Hand-writing 미 제출 시 0 점 처리 조교 : 전지선 ( ) 과학원 S303 호 ( 내선 7642) Report

생화학 실험 (2) 중간고사 일시 : 10 월 24 일 목요일 7-8 교시 장소 : 과학관 B131 Exam.